Top » Catalog » N » A918

$18.00

A918
[A918]

A918
hg38 Position: ChrY:19930054..19930054
Ancestral: A
Derived: G
Reference: YSEQ (2014)
ISOGG Haplogroup: N1c1a1a1a1 (not listed)
Comments: Below L1025 with Y4706
Forward Primer: A918_F TTGACTGGGTAAACTGAACTGC
Reverse Primer: A918_F TTGACTGGGTAAACTGAACTGC
Reviews

Customers who bought this product also purchased
A710
A710
A704
A704
A709
A709
A703
A703
A708
A708
A917
A917
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies