Top » Catalog » N » A14187

$18.00

A14187
[A14187]

A14187
hg38 Position: ChrY:11897428..11897428
Ancestral: G
Derived: A
Reference: Andrei Shkiperov (2017)
ISOGG Haplogroup: N1a1a1a1a1a2a1a2a
Comments: .
Forward Primer: A14187_F GAGAGAGACAGTGTGACCTAGCG
Reverse Primer: A14187_R TTTAACATGTCATCAAGAAATAACCATAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20218
1 x BY20078
1 x BZ1307
$54.00
Haplogroup Info
Other products
Currencies