Top » Catalog » N » A16526

$18.00

A16526
[A16526]

A16526
hg38 Position: ChrY:8413535..8413535
Ancestral: C
Derived: T
Reference: Andrei Shkiperov (2017)
ISOGG Haplogroup: N1a1a1a1a1a2a1a3
Comments: Y7300+
Forward Primer: A16526_F GAATTTACTTCATTATAGAAATAAAGCCAC
Reverse Primer: A16526_R GAAATGGAGTCTTGCTCTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16141
1 x BZ3140
1 x FGC14165
1 x SK1376
$72.00
Haplogroup Info
Other products
Currencies