Top » Catalog » N » A17082

$18.00

A17082
[A17082]

A17082
hg38 Position: ChrY:21592278..21592278
Ancestral: C
Derived: A
Reference: Andrei Shkiperov (2017)
ISOGG Haplogroup: N1a1a1a1a1a2a1a2e2
Comments: Y5003+ Y24001-
Forward Primer: A17082_F CAAGAAGAGCCCCAGGAATAAG
Reverse Primer: A17082_R TCCACATGTTCCTTGCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS1392
1 x A13913
$36.00
Haplogroup Info
Other products
Currencies