Top » Catalog » N » A19397

$18.00

A19397
[A19397]

A19397
hg38 Position: ChrY:13686513..13686513
Ancestral: G
Derived: A
Reference: Andrei Shkiperov (2017)
ISOGG Haplogroup: N1a1a1a1a1a2a1a2a1a
Comments: Below L1022 > Y7300 > Y15812
Forward Primer: A19397_F TGGCATATACACAACCATAGAATACTAG
Reverse Primer: A19397_R CAAAGGGATTCTGTCCGAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19345
1 x BY25075
1 x Y46378
$54.00
Haplogroup Info
Other products
Currencies