Top » Catalog » N » BY33087

$18.00

BY33087
[BY33087]

BY33087
hg38 Position: ChrY:8109700..8109700
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: N
Comments: Downstream CTS3451
Forward Primer: BY33087_F TAGAAATACAACAGTATTAGGAACATCTTTC
Reverse Primer: BY33087_R TTTGAAAATGTGTGGCACTTTC
Reviews

Customers who bought this product also purchased
CTS657
CTS657
Y3669
Y3669
CTS6904
CTS6904
CTS9976
CTS9976
L395
L395
L550
L550
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y19451
1 x A869
$36.00
Haplogroup Info
Other products
Currencies