Top » Catalog » N » Y20621

$18.00

Y20621
[Y20621]

Y20621
hg38 Position: ChrY:13304494..13304494
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below Y10756 > PH547
Forward Primer: Y20621_F TTCCAAATCTCAACAAAAGTGC
Reverse Primer: Y20621_R TGGGGCTCAAATACTGTGTTC
Reviews

Customers who bought this product also purchased
Y5005
Y5005
Y20624
Y20624
M2783
M2783
Y20623
Y20623
L550
L550
A13135
A13135
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies