Top » Catalog » N » Y20621

$18.00

Y20621
[Y20621]

Y20621
hg38 Position: ChrY:13304494..13304494
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below Y10756 > PH547
Forward Primer: Y20621_F TTCCAAATCTCAACAAAAGTGC
Reverse Primer: Y20621_R TGGGGCTCAAATACTGTGTTC
Reviews

Customers who bought this product also purchased
L550
L550
A13135
A13135
Y5004
Y5004
PH2196
PH2196
Y24594
Y24594
N1a-VL29 Panel
N1a-VL29 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies