Top » Catalog » N » Y23180

$18.00

Y23180
[Y23180]

Y23180
hg38 Position: ChrY:7834791..7834791
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: N
Comments: Below Y17799
Forward Primer: Y23180_F ACACAGGCAACTGAAAAAGCC
Reverse Primer: Y23180_R GGTGAGAATCTTTTTGTTTTCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HU196
1 x Y17026
1 x Y18418
1 x BZ2973
1 x Y32092
1 x Y24361
$108.00
Haplogroup Info
Other products
Currencies