Top » Catalog » O » F3085

$18.00

F3085
[F3085]

F3085
hg38 Position: ChrY:17454387..17454387
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: O2a2a1a2a1a
Comments: Found in a hg O3 person.
Forward Primer: F3085_F GAAATGGGAACATGTTGATCC
Reverse Primer: F3085_R AACTATGCTCCTTACCTTGGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F9815
1 x CTS610
1 x CTS3270
1 x SK1578
$72.00
Haplogroup Info
Other products
Currencies