Top » Catalog » O » CTS11688

$18.00

CTS11688
[CTS11688]

CTS11688
hg38 Position: ChrY:21063747..21063747
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: O1a1a
Comments: Syn. with CTS10963; downstream CTS10777
Forward Primer: CTS11688_F ATGTGGAAACAAGGCTAGGTG
Reverse Primer: CTS11688_R GACCTGTGCCCACTGTCTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR1
1 x Z23256
1 x AM01828
1 x F19245
1 x E341
1 x F14315
1 x Y23
$133.00
Haplogroup Info
Other products
Currencies