Top » Catalog » O » A12446

$18.00

A12446
[A12446]

A12446
hg38 Position: ChrY:8614380..8614380
Ancestral: G
Derived: T
Reference: Xin Lu (2016)
ISOGG Haplogroup: O1b2a1a2a1b
Comments: Below CTS723
Forward Primer: A12446_F ATCCCCTTGGGTTTTCATTC
Reverse Primer: A12446_R TGAGCCAGACCTCAGAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1566
$18.00
Haplogroup Info
Other products
Currencies