Top » Catalog » O » A12442

$18.00

A12442
[A12442]

A12442
hg38 Position: ChrY:16674658..16674658
Ancestral: G
Derived: A
Reference: Xin Lu (2016)
ISOGG Haplogroup: O
Comments: .
Forward Primer: A12442_F ACAGGCACATGCCACCATAC
Reverse Primer: A12442_R GCCCTTCTTAGGAGATTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies