Top » Catalog » O » K10

$18.00

K10
[K10]

K10
hg38 Position: ChrY:8650993..8650993
Ancestral: C
Derived: T
Reference: Youngmin JeongAhn (2013)
ISOGG Haplogroup: O1b2a1a
Comments: Subgroup under O-M176
Forward Primer: K10_F AAAAAGGAAACCCCAAACAG
Reverse Primer: K10_R CCCAACACCACTGTTCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x K644
$18.00
Haplogroup Info
Other products
Currencies