Top » Catalog » O » CTS5741

$18.00

CTS5741
[CTS5741]

CTS5741
hg38 Position: ChrY:14352158..14352158
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: O2a2b1a2a1a3b2b2 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified. Below CTS3856
Forward Primer: CTS5741_F GCCAGGCAATTATTGCTTTC
Reverse Primer: CTS5741_R GATTCTCCGGCAAATTTTTTATATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies