Top » Catalog » O » S22379

$18.00

S22379
[S22379]

S22379
hg38 Position: ChrY:17399826..17399826
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: O2a2a1a1a (not listed)
Comments: Below S15830
Forward Primer: S22379_F GCCCATGTATATTTTTGGGTAG
Reverse Primer: S22379_R TGAAAGCAATGCCTCCAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1992
1 x F2524
$36.00
Haplogroup Info
Other products
Currencies