Top » Catalog » O » F4110

$18.00

F4110
[F4110]

F4110
hg38 Position: ChrY:8655941..8655941
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: O2a2b2a1a
Comments: Found in a hg O3 person. Likely a singleton.
Forward Primer: F4110_F AAACGTTTCCCAGTTCATGG
Reverse Primer: F4110_R AAAGTGCAAACCGCCTTATC
Reviews

Customers who bought this product also purchased
O Superclade Panel
O Superclade Panel
F1903
F1903
F871
F871
P201
P201
F100
F100
M122
M122
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS2022
1 x SK1803
1 x F134
$54.00
Haplogroup Info
Other products
Currencies