Top » Catalog » O » A16430

$18.00

A16430
[A16430]

A16430
hg38 Position: ChrY:13240291..13240291
Ancestral: C
Derived: T
Reference: Xin Lu (2017)
ISOGG Haplogroup: O2a2b2a2b2c
Comments: .
Forward Primer: A16430_F CCTGAAAAGTCAGCACACAGAC
Reverse Primer: A16430_R TTGGGGTAAACCATTCTGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies