Top » Catalog » O » A16434

$18.00

A16434
[A16434]

A16434
hg38 Position: ChrY:11890608..11890608
Ancestral: G
Derived: A
Reference: Xin Lu (2017)
ISOGG Haplogroup: O2a2b2b
Comments: .
Forward Primer: A16434_F TGTCTGGGGAGGTTTCACTG
Reverse Primer: A16434_R CTAACCCCAAACTGCCACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies