Top » Catalog » O » A16435

$18.00

A16435
[A16435]

A16435
hg38 Position: ChrY:14169542..14169542
Ancestral: A
Derived: G
Reference: Xin Lu (2017)
ISOGG Haplogroup: O2a2b2b
Comments: .
Forward Primer: A16435_F CCCAACTTCCAACCTGTGAG
Reverse Primer: A16435_R CAGACAGCCAGGGTATTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F23759
$18.00
Haplogroup Info
Other products
Currencies