Top » Catalog » O » A16442

$18.00

A16442
[A16442]

A16442
hg38 Position: ChrY:12008191..12008191
Ancestral: C
Derived: T
Reference: Xin Lu (2017)
ISOGG Haplogroup: O2a2b2b1b
Comments: .
Forward Primer: A16442_F CTGTTGTTTCTTGACTTTTTAATGATTG
Reverse Primer: A16442_R CCATAAAAACCCTAGAAGAAAAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x AM00566
$18.00
Haplogroup Info
Other products
Currencies