Top » Catalog » O » A16443

$18.00

A16443
[A16443]

A16443
hg38 Position: ChrY:12275690..12275690
Ancestral: A
Derived: G
Reference: Xin Lu (2017)
ISOGG Haplogroup: O2a2b2b1b
Comments: .
Forward Primer: A16443_F CCTGTCTCTACTAAAAATACAAAAATTAGCTG
Reverse Primer: A16443_R TAATATTTTTTGTAGAGACAGGGTCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies