Top » Catalog » O » A16644

$18.00

A16644
[A16644]

A16644
hg38 Position: ChrY:21072602..21072602
Ancestral: A
Derived: C
Reference: Xin Lu (2017)
ISOGG Haplogroup: O
Comments: Below F2137
Forward Primer: A16644_F AATGCTGTGAATCCATTAGGTG
Reverse Primer: A16644_R GAAAAAATAGTCAAAACACATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies