Top » Catalog » O » A17447

$18.00

A17447
[A17447]

A17447
hg38 Position: ChrY:20769010..20769010
Ancestral: G
Derived: A
Reference: Xin Lu (2017)
ISOGG Haplogroup: O
Comments: Below B451
Forward Primer: A17447_F TGACTCATGATGCTCGAACC
Reverse Primer: A17447_R TTCCCCTCTCATGACAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS2022
$18.00
Haplogroup Info
Other products
Currencies