Top » Catalog » O » YFS097110

$18.00

YFS097110
[YFS097110]

YFS097110
hg38 Position: ChrY:11911836..11911836
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: O3a1c1 (not listed)
Comments: .
Forward Primer: YFS097110_F AAATTACATGGATGTACACAGATGG
Reverse Primer: YFS097110_R TTGAGACAGAGTCCCGCTCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F450
$18.00
Haplogroup Info
Other products
Currencies