Top » Catalog » O » F4119

$18.00

F4119
[F4119]

F4119
hg38 Position: ChrY:8762307..8762307
Ancestral: C
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: O2a1c1a6a2
Comments: Found in a hg O3 person. Likely a singleton.
Forward Primer: F4119_F AAAGCAAGAGGCAATCATGG
Reverse Primer: F4119_R TAGGGCCCCTTGAATTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F99
$18.00
Haplogroup Info
Other products
Currencies