Top » Catalog » other » A3046

$18.00

A3046
[A3046]

A3046
hg38 Position: ChrY:7406777..7406777
Ancestral: A
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3046_F TCATTGAATCTTCTCATATGATCTCG
Reverse Primer: A3046_R AAGAACAAAATAATTAGCCAGGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x AMM481
$18.00
Haplogroup Info
Other products
Currencies