Top » Catalog » other » A3047

$18.00

A3047
[A3047]

A3047
hg38 Position: ChrY:8835708..8835708
Ancestral: T
Derived: C
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3047_F GAGTCTTACAATGCACCCAAAG
Reverse Primer: A3047_R CAGCTTCCTCCTCTTTTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies