Top » Catalog » other » A3048

$18.00

A3048
[A3048]

A3048
hg38 Position: ChrY:8851012..8851012
Ancestral: A
Derived: G
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3048_F CTTTTTTAAACTCAAGTGTCTTCAACTAAG
Reverse Primer: A3048_R AAAATCAAACTAGTTAAAAGTCACAATTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies