Top » Catalog » other » A3071

$18.00

A3071
[A3071]

A3071
hg38 Position: ChrY:12775130..12775130
Ancestral: T
Derived: C
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3071_F CGGTGTTCCATTAAAACCAG
Reverse Primer: A3071_R TCTGAACAAAGCCGTTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies