Top » Catalog » other » A3074

$18.00

A3074
[A3074]

A3074
hg38 Position: ChrY:13248722..13248722
Ancestral: A
Derived: G
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3074_F TGTTCTCTAAAAGAGGTTATCATTCTG
Reverse Primer: A3074_R GGGTTTCCCAATGTTTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY3727
1 x BY1333
1 x BY939
1 x A3047
1 x A12772
1 x BY3298
1 x BY3931
1 x BY472
1 x BY5068
1 x BY4421
1 x A23020
$198.00
Haplogroup Info
Other products
Currencies