Top » Catalog » other » A3079

$18.00

A3079
[A3079]

A3079
hg38 Position: ChrY:14058726..14058726
Ancestral: T
Derived: G
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A3079_F TGATATAGATGATATATATCTGTTAGAAATACGC
Reverse Primer: A3079_R ATTAGTGCTTTACATCTCAAACCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies