Top » Catalog » other » A2878

$18.00

A2878
[A2878]

A2878
hg38 Position: ChrY:17219839..17219839
Ancestral: A
Derived: G
Reference: YSEQ (2015)
ISOGG Haplogroup: A0-T
Comments: Found ancestral in an A00 person
Forward Primer: A2878_F TTTATGAAGTTATTTAAATAAAATTGGAGC
Reverse Primer: A2878_R CAGCACCACCCAGTAAATTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY2093
$18.00
Haplogroup Info
Other products
Currencies