Top » Catalog » other » A9739

$18.00

A9739
[A9739]

A9739
hg38 Position: ChrY:16447272..16447272
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: unknown
Comments: Observed in I1-Z17928 and E-V13
Forward Primer: A9739_F TGGCTAATTTTTAATAGGGTCTCATTAC
Reverse Primer: A9739_R TGCACAGGTTTTGAAGAACATC
Reviews

Customers who bought this product also purchased
E1b-V13 Panel
E1b-V13 Panel
Y172393
Y172393
A18833
A18833
Z19851
Z19851
Z5017
Z5017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies