Top » Catalog » other » A577

$18.00

A577
[A577]

A577
hg38 Position: ChrY:7962291..7962291
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: A577_F GTTTCAGGGAGGCTCCCTAG
Reverse Primer: A577_R AAGCTTACAGAAATTTGCAGCAG
Reviews

Customers who bought this product also purchased
CTS12937
CTS12937
Wish a SNP
Wish a SNP
A575
A575
A574
A574
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY2093
$18.00
Haplogroup Info
Other products
Currencies