Top » Catalog » other » BY4233

$18.00

BY4233
[BY4233]

BY4233
hg38 Position: ChrY:3002936..3002936
Ancestral: A
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: R
Comments: .
Forward Primer: BY4233_F CACAAGACATGCCTGAGTTACAAG
Reverse Primer: BY4233_R CGAGGTCCTGTAGCACACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY578
1 x BY3226
1 x BY856
1 x BY3632
1 x AM01918
$90.00
Haplogroup Info
Other products
Currencies