Top » Catalog » other » A670

$18.00

A670
[A670]

A670
hg38 Position: ChrY:8465228..8465228
Ancestral: G
Derived: N
Reference: William Hartley (2014)
ISOGG Haplogroup: unknown
Comments: This was a typo in the position. No known mutation on this position.
Forward Primer: A670_F AACACAGGAGACTGTGAATCTCATAC
Reverse Primer: A670_R CAATATGTAATCACCACCTCTCTGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies