Top » Catalog » other » B252

$18.00

B252
[B252]

B252
hg38 Position: ChrY:7236948..7236948
Ancestral: C
Derived: A
Reference: Karmin et al. (2015)
ISOGG Haplogroup: P2
Comments: .
Forward Primer: B252_F ATTTCAGGCTGGGTGCAG
Reverse Primer: B252_R TTCTCTGAGGTGGCATCTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies