Top » Catalog » other » A17585

$18.00

A17585
[A17585]

A17585
hg38 Position: ChrY:8051201..8051201
Ancestral: G
Derived: A
Reference: Perry Gillespie (2017)
ISOGG Haplogroup: I
Comments:
Forward Primer: A17585_F AATCAGGACATGTGGCATTG
Reverse Primer: A17585_R AAGAATACCCTCCCCTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY4206
$18.00
Haplogroup Info
Other products
Currencies