Top » Catalog » other » A17586

$18.00

A17586
[A17586]

A17586
hg38 Position: ChrY:10084693..10084693
Ancestral: G
Derived: T
Reference: Perry Gillespie (2017)
ISOGG Haplogroup: I
Comments:
Forward Primer: A17586_F AAAGCAATCAAAATATCCACTTGC
Reverse Primer: A17586_R GAAGGAAGTATCTTCGCATAAGAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY2874
1 x BY2855
$36.00
Haplogroup Info
Other products
Currencies