Top » Catalog » other » A17587

$18.00

A17587
[A17587]

A17587
hg38 Position: ChrY:12703392..12703392
Ancestral: A
Derived: G
Reference: Perry Gillespie (2017)
ISOGG Haplogroup: I
Comments:
Forward Primer: A17587_F TGAGGAGCTGGGACTACAGG
Reverse Primer: A17587_R TTGCTGCCACTCACTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY1110
$18.00
Haplogroup Info
Other products
Currencies