Top » Catalog » other » A18201

$18.00

A18201
[A18201]

A18201
hg38 Position: ChrY:13428069..13428069
Ancestral: T
Derived: C
Reference: Thomas Fleming (2017)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: A18201_F AATGGCCCTTCTGACTTGG
Reverse Primer: A18201_R GGTTGCTGGAACAGAATCAAG
Reviews

Customers who bought this product also purchased
A18199
A18199
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY3924
1 x BY3819
1 x BY3463
$54.00
Haplogroup Info
Other products
Currencies