Top » Catalog » other » A4434

$18.00

A4434
[A4434]

A4434
hg38 Position: ChrY:20418220..20418220
Ancestral: G
Derived: T
Reference: YSEQ (2015)
ISOGG Haplogroup: none
Comments: Found in an A00a person. Could not be confirmed with Sanger sequencing
Forward Primer: A4434_F TTTTCTCCTTTTAATTGTGGATTTG
Reverse Primer: A4434_R AACACCACATTCCAAATTTATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23098
1 x BY2834
$36.00
Haplogroup Info
Other products
Currencies