Top » Catalog » other » A954

$18.00

A954
[A954]

A954
hg38 Position: ChrY:19446323..19446323
Ancestral: A
Derived: G
Reference: Depreciated
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: A954_F TTCCTAACAGGACCCATTTAGAAC
Reverse Primer: A954_R GGATTGAGCAACTATTTACCACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15062
1 x BY4729
1 x A4748
$54.00
Haplogroup Info
Other products
Currencies