Top » Catalog » Q » JN17

$18.00

JN17
[JN17]

JN17
hg38 Position: ChrY:12005019..12005019
Ancestral: C
Derived: T
Reference: Jakob Norstedt-Moberg (2015)
ISOGG Haplogroup: Q1a2a1a2
Comments: .
Forward Primer: JN17_F GAGGCTCTAGGCATCTCTGG
Reverse Primer: JN17_R GGAGTGAGGCAGATACAAGC
Reviews

Customers who bought this product also purchased
JN21
JN21
JN19
JN19
JN18
JN18
JN16
JN16
JN14
JN14
JN22
JN22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies