Top » Catalog » Q » FGC1886

$18.00

FGC1886
[FGC1886]

FGC1886
hg38 Position: ChrY:3280679..3280679
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: Q1b1a1a1a1
Comments: Aka Y2233 - Found in a Q-M378 person
Forward Primer: FGC1886_F GCTGGGACTACAAGCGAAAG
Reverse Primer: FGC1886_R CTCATTCAAATCTTCGAATTATTATTTG
Reviews (1)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies