Top » Catalog » Q » FGC6871

$18.00

FGC6871
[FGC6871]

FGC6871
hg38 Position: ChrY:7671344..7671344
Ancestral: A
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: Q1a2b1 (not listed)
Comments: Found in a Q-L527 person
Forward Primer: FGC6871_F CAGATATCTTAAACTTTAGTATCAACCGC
Reverse Primer: FGC6871_R TTACAATGCAAAATGGCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies