Top » Catalog » Q » BZ462

$18.00

BZ462
[BZ462]

BZ462
hg38 Position: ChrY:19212984..19212984
Ancestral: C
Derived: A
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q
Comments: YP4500
Forward Primer: BZ462_F GGAAGAACAGGGGACTAGGG
Reverse Primer: BZ462_R CTGGCTTCACCTCTCTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22886
1 x Y6469
$36.00
Haplogroup Info
Other products
Currencies