Top » Catalog » Q » BZ144

$18.00

BZ144
[BZ144]

BZ144
HG19 Position: ChrY:21152262..21152262
Ancestral: T
Derived: A
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q
Comments: Y2209*
Forward Primer: BZ144_F TGCAGGCTGGAAACAAGAG
Reverse Primer: BZ144_R GGCCTTATCTCCTTGTCAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies