Top » Catalog » Q » BZ157

$18.00

BZ157
[BZ157]

BZ157
hg38 Position: ChrY:20596472..20596472
Ancestral: C
Derived: T
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q
Comments: Y2209*
Forward Primer: BZ157_F CCAATGCCATTCATTCTTCAC
Reverse Primer: BZ157_R CAGCTTTCCCAGATTGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23763
1 x BY6038
1 x BY5895
1 x Y13979
1 x BY9999
1 x BY35522
$108.00
Haplogroup Info
Other products
Currencies