Top » Catalog » Q » BZ3004

$18.00

BZ3004
[BZ3004]

BZ3004
HG19 Position: ChrY:11957475..11957475
Ancestral: T
Derived: C
Reference: Vladimir Gurianov (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BZ3004_F TCTCTGTGGTGCTGATCCTG
Reverse Primer: BZ3004_R TACAGCAGTGGCAGCTAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC67293
1 x CTS9501
$36.00
Haplogroup Info
Other products
Currencies